rs936236 chr4:25968703 C>T
- Sequence
cacttcccaaataaaccacttgca[C/T]ggaaattgttgtctcagagtctgc
- ASB in cell types
- NALM-6 (adult B acute lymphoblastic leukemia) germinal center B-cells SEM (childhood B acute lymphoblastic leukemia) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- IKZF1_HUMAN CBP_HUMAN RUNX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 3.27 | -3.41 | 1.25 | n/a | n/a | |||
| CBP_HUMAN | 3.21 | n/a | 2.00 | n/a | n/a | |||
| RUNX2_HUMAN | 2.42 | -2.23 | 1.33 | -0.87 | Weak Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP adiponectin levels, irritible bowel syndrome, microalbuminuria, rheumatoid arthritis, sporadic creutzfeldt-jakob disease, triglycerides change with statins, urinary albumin-to-creatinine ratio