rs937817 chr18:58768429 G>A
- Sequence
ctggccacctagcccagagggcat[G/A]atgggcccagcgagaaaccctggg
- ASB in cell types
- HCT-116 (colon carcinoma) sigmoid colon CUTLL1 (T-cell lymphoblastic lymphoma 1)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | 0.10 | 1.16 | 1.06 | |||
| sigmoid colon | 2.24 | -2.06 | 1.00 | |||
| CUTLL1 (T-cell lymphoblastic lymphoma 1) | 1.96 | -0.86 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Colon_Transverse, Esophagus_Muscularis, Nerve_Tibial, Testis