rs938602 chr18:23812714 G>A
- Sequence
cgtcttttaaatgggcaattaaaa[G/A]tctcttggtacaatattgccctct
- ASB in cell types
- IPSC-derived bipolar neuron GM12878 (female B-cells lymphoblastoid cell line) bipolar neuron erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| IPSC-derived bipolar neuron | 1.63 | -0.39 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.95 | 0.52 | 1.11 | |||
| bipolar neuron | 0.94 | -0.73 | 1.00 | |||
| erythroid progenitors | n/a | 2.48 | 2.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid