rs939348 chr17:40075600 T>C
- Sequence
ctgtgggtctggaagagtctgtgc[T/C]taatgtttggagaaaggcaggaat
- ASB in cell types
- erythroid cells pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 2.82 | -5.34 | 2.00 | |||
| pancreas | -0.60 | 0.97 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Testis, Thyroid