rs940051 chr3:156456039 A>T
- Sequence
cttcatgcaggaggaggagatccc[A/T]gaacaaaatcaaccccattttgca
- ASB in cell types
- GM02630 (Fanconi anemi) GM02610 (Lymphoblastoid Cell Lines) MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | 2.08 | -1.68 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | -1.15 | 1.62 | 1.00 | |||
| MM1.S (plasma cell myeloma) | -0.50 | 1.84 | 2.00 |
Items per page:
1 – 3 of 3