rs940233 chr3:138375763 G>A
- Sequence
tgggcgctgtggcttacaaggcct[G/A]taaatcccaacactttgggaggct
- ASB in cell types
- SEM (childhood B acute lymphoblastic leukemia)
- ASB for transcription factors
- RUNX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RUNX2_HUMAN | -2.41 | 2.72 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, cystatin c in serum, diastolic blood pressure (dbp), fasting insulin, homa-ir, systolic blood pressure (sbp)
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid