rs940474 chr5:142713663 G>C
- Sequence
tcacctctccatctccggctcctc[G/C]ctgctctggctccttaaagtcctg
- ASB in cell types
- CD34+ stem cells-derived erythroblasts spleen
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | 1.76 | -0.69 | 2.00 | |||
| spleen | 1.72 | -0.50 | 1.00 |
Items per page:
1 – 2 of 2