rs941587 chr14:92923619 C>G
- Sequence
cacttgggcctgactcccaacccc[C/G]cggggcaactcccccttgtgccca
- ASB for transcription factors
- REST_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | 1.02 | 1.26 | 1.36 | -1.81 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
