rs941764 chr14:91374725 A>G
- Sequence
ggcagcatctgcagtggtctctgc[A/G]gtcaggctcattccgaagcctcag
- ASB for transcription factors
- SMCA5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA5_HUMAN | 2.41 | -2.01 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP breast cancer, breast cancer (estrogen receptor positive breast cancer), breast cancer (invasive breast cancer), height, infant head circumference, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg