rs941823 chr13:40439840 T>C
- Sequence
ggccccctttactctatgttatta[T/C]tggagaaaagccaccatgcaagat
- ASB for transcription factors
- PPARG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PPARG_HUMAN | 1.40 | -0.69 | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI chronic inflammatory diseases (ankylosing spondylitis, crohns disease, psoriasis, primary sclerosing cholangitis, ulcerative colitis) (pleiotropy), inflammatory bowel disease, ulcerative colitis
GRASP crohns disease, height, inflammatory bowel disease, lp-pla2 activity, nonsyndromic cleft lip, ulcerative colitis
PheWAS abnormal chest sounds, adjustment reaction, adverse effects of opiates and related narcotics in therapeutic use, allergic rhinitis, aneurysm of iliac artery, anxiety, phobic and dissociative disorders, aplastic anemia, aseptic necrosis of bone, bacterial enteritis, blindness and low vision, calcium/phosphorus disorders, calculus of bile duct, cardiac pacemaker in situ, cellulitis and abscess of foot/toes, cerebral edema and compression of brain, cholecystitis without cholelithiasis, chronic lymphocytic thyroiditis, chronic pharyngitis and nasopharyngitis, circumscribed scleroderma, complication of internal orthopedic device, congenital anomalies of posterior segment of eye, congenital anomalies of the eye, congenital deformities of feet, convulsions, curvature of spine, decreased white blood cell count, decubitus ulcer, deficiency anemias nos, diffuse diseases of connective tissue, diseases of pulp and periapical tissues, disorders of binocular eye movements, disorders of conjunctiva, dysthymic disorder, electrolyte imbalance, epiphora, epistaxis or throat hemorrhage, generalized anxiety disorder, genital prolapse, heart transplant/surgery, heartburn, hemorrhoids, idiopathic fibrosing alveolitis, infections involving bone, inflammatory conditions of jaw, insomnia, intervertebral disc disorder with myelopathy, jaundice, jaw disease nos, labyrinthitis, lupus erythematosus, male genital disorders, mental retardation, nephrotic syndrome without mention of glomerulonephritis, nervous system congenital anomalies, nonrheumatic tricuspid valve disorders, obesity, osteomyelitis, other conditions of brain, other specified cardiac dysrhythmias, other specified erythematous conditions, otitis media, overweight, pain, swelling or discharge of eye, pallor and flushing, periodontitis (acute or chronic), pernicious or b12 deficiency anemia, phosphorus metabolism disorder, pituitary hyperfunction, primary pulmonary hypertension, prolapse of vaginal walls, prostate cancer, pyogenic arthritis, raynauds syndrome, redundant prepuce and phimosis/bxo, renal failure, rhabdomyolysis, right bundle branch block, scoliosis, sicca syndrome, systemic sclerosis, unspecified monoarthritis, unspecified osteomyelitis, venous embolism & thrombosis, viral hepatitis c, visual field defects