rs942031 chr13:49679352 G>A
- Sequence
catctggaactaagattcatgttt[G/A]agctcaacaagcactgaggatcta
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) GM19240 (B cells Lymphoblastoid Cell Lines) GM17942 (lymphoblastoid cell) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 2.33 | -1.48 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 1.80 | -0.45 | 1.00 | |||
| GM17942 (lymphoblastoid cell) | 2.15 | -1.95 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 0.97 | -0.76 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood