rs942125 chr1:58841618 G>A
- Sequence
tgctgggaagagccattttcccca[G/A]ggcaggccagggaaccccatcagc
- ASB in cell types
- K562 (myelogenous leukemia) GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.04 | 0.87 | 1.89 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 0.65 | 1.16 | 1.00 |
Items per page:
1 – 2 of 2