rs942201 chr10:6044329 G>T
- Sequence
tagttccggctgtgctacagctcc[G/T]tgactgcttctgtagagcagggcg
- ASB in cell types
- SEM (childhood B acute lymphoblastic leukemia)
- ASB for transcription factors
- RUNX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RUNX2_HUMAN | 2.36 | -3.83 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, alopecia areata, college completion, neuroblastoma (brain cancer), paternal transmission distortion, rheumatoid arthritis, type 1 diabetes, combined control dataset