rs944260 chr20:61668355 G>A
- Sequence
tttagcccaggctgccccgaagcc[G/A]cagaggatgcacctgcctggaaaa
- ASB for transcription factors
- PAX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PAX2_HUMAN | -1.43 | 1.71 | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, college completion, eye color, fasting insulin, homa-ir, myocardial infarction (mi), sudden cardiac arrest in patients with coronary artery disease (cad), sporadic creutzfeldt-jakob disease, years of education
PheWAS abnormal findings on exam of gastrointestinal tract/abdominal area, abnormal pulmonary function, acute bronchospasm, ankylosis of joint, arthropathy nos, benign neoplasm of brain and other parts of nervous system, benign neoplasm of thyroid glands, calculus of ureter, cardiac pacemaker in situ, chronic pharyngitis and nasopharyngitis, chronic venous insufficiency, cns infection and poliomyelitis, cyst and pseudocyst of pancreas, disease of capillaries, fibroadenosis of breast, functional digestive disorders, glossitis, hemoptysis, herpes simplex, hyperparathyroidism, hypoventilation, irritable bowel syndrome, joint/ligament sprain, liver abscess and sequelae of chronic liver disease, mastoiditis, mixed hyperlipidemia, nephrotic syndrome without mention of glomerulonephritis, osteoarthrosis of multiple sites, other disorders of prostate, other infectious diseases, other specified disorders of plasma protein metabolism, otosclerosis, pain in joint, peripheral retinal degenerations, photodermatitis & sunburn, pneumoconiosis, pneumonia, polymyalgia rheumatica, portal hypertension, protein plasma/amino-acid transport and metabolism disorder, ptosis of eyelid, retinal drusen, retinoschisis and retinal cysts, rhabdomyolysis, scar conditions and fibrosis of skin, sialoadenitis, substance addiction and disorders, superficial cellulitis and abscess, type 1 diabetes nephropathy, viral hepatitis c