rs944730 chr1:217630983 G>A
- Sequence
cggccccgaacattaacgacaccc[G/A]ggagcctggcctcgaagctcaggc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma) MCF-7 C4-12 (invasive breast ductal carcinoma) MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line)
- ASB for transcription factors
- TYY1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | -4.86 | 3.37 | 1.50 | n/a | No Hit | |||
| CTCF_HUMAN | 0.63 | 0.89 | 1.31 | n/a | No Hit |
Items per page:
1 – 2 of 2