rs945492 chr10:35781158 G>A
- Sequence
gagaaatgaggaatgtcagccagt[G/A]gaggtccaccttctgcagtgaaaa
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HS-SY-2(Monophasic synovial sarcoma) | n/a | 2.39 | 3.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | -2.75 | 2.65 | 1.00 |
Items per page:
1 – 2 of 2