rs945888 chr11:7673531 A>G
- Sequence
ccggaatccgagccggcccgcccc[A/G]ctccccgcccttcgcggtcccgcc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ELF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | 3.11 | -0.51 | 1.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood