rs946308 chr1:58245064 C>A
- Sequence
gtccacaactgctcaccaaagtat[C/A]aagagacagactctctccatggtt
- ASB in cell types
- liver GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 2.55 | 0.17 | 1.50 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.16 | 1.34 | 1.40 |
Items per page:
1 – 2 of 2