rs947252 chr1:56303000 G>A
- Sequence
ctctaaaccactttctacactgta[G/A]catgaccatgttgttcttccacta
- ASB in cell types
- PC3(bone mets prostate adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC3(bone mets prostate adenocarcinoma) | 0.12 | 2.31 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, chronic kidney disease, fasting blood glucose, hdl cholesterol change with statins, height, homa-b, microalbuminuria, serum creatinine, triglycerides change with statins