rs947470 chr10:6347643 A>G
- Sequence
attcaaatccagagaaaaaaacgg[A/G]agcctcgaactgcatctgaaaacc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) germinal center B-cells
- ASB for transcription factors
- CBP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CBP_HUMAN | 2.28 | -1.54 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP irritible bowel syndrome, ldl cholesterol change with statins, prostate cancer, rheumatoid arthritis, salmonella-induced pyroptosis, schizophrenia, transmission distortion