rs947583 chr6:135812521 T>C
- Sequence
atctttctccaccacatacatttt[T/C]agtgggccctctcacaaatgcctg
- ASB in cell types
- BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 1.07 | 0.20 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, mitral annular calcium, neuroblastoma (brain cancer), premature ovarian failure, schizophrenia, serum phosphorous, sporadic creutzfeldt-jakob disease
PheWAS abnormal findings examination of lungs, adverse effects of antineoplastic and immunosuppressive drugs, altered mental status, aneurysm of iliac artery, anisometropia, arteritis nos, arthropathy associated with infections, aseptic necrosis of bone, back & neck sprains, benign neoplasm of brain and other parts of nervous system, benign neoplasm of colon, benign neoplasm of thyroid glands, benign neoplasm of uterus, bladder cancer, bladder cancer and neoplasms, cancer of kidney and urinary organs, cholesteatoma, chronic rheumatic disease of the heart valves, chronic ulcer of leg or foot, chronic ulcer of skin, chronic venous hypertension, coagulation defects, complication of amputation stump, conduct disorders, dermatophytosis of the body, diseases of esophagus, esophagitis, gerd and related diseases, femoral hernia, fracture of ribs, gastritis and duodenitis, gerd, gram negative septicemia, hemorrhagic disorder due to intrinsic circulating anticoagulants, iatrogenic hypothyroidism, ill-defined descriptions and complications of heart disease, inflammatory conditions of jaw, inflammatory disease of breast, kyphosis (acquired), macular degeneration, dry, malaise and fatigue, male genital disorders, muscular dystrophies and other myopathies, osteoarthrosis, localized, primary, osteopenia, other disorders of middle ear and mastoid, other disorders of peritoneum, other peripheral nerve disorders, other specified disorders of liver, other specified osteoporosis, other specified peripheral vascular diseases, other unspecified back disorders, peritoneal adhesions (postoperative) (postinfection), pleurisy, pleural effusion, pneumoconiosis, poisoning by primarily systemic agents, secondary malignancy of bone, secondary malignancy of brain/spine, symptoms involving nervous and musculoskeletal systems, ulceration of intestine, ulceration of the lower gi tract, viral warts & hpv, visual disturbances
GTEx eQTL Adipose_Subcutaneous, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood