rs947627 chr9:128011657 T>A
- Sequence
agggggttatttactgtagcactg[T/A]ttgtcatggcaaagaactggaagc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | -5.01 | 1.85 | 2.50 |
Items per page:
1 – 1 of 1