rs948316 chr11:68542202 G>T
- Sequence
tacatgcaggagatgacctcagga[G/T]caagggccactcccctggagcgag
- ASB in cell types
- macrophages form periferal blood CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 1.47 | -0.55 | 2.00 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.18 | 0.99 | 1.00 |
Items per page:
1 – 2 of 2