rs948969 chr11:77136989 A>G
- Sequence
agtgtcctctgtactttagtctga[A/G]cctgtactcagtgaaggtcggtta
- ASB in cell types
- liver
- ASB for transcription factors
- HNF4A_HUMAN RXRA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNF4A_HUMAN | 4.06 | -4.05 | 1.00 | n/a | No Hit | |||
| RXRA_HUMAN | 2.27 | n/a | 1.00 | -2.53 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), birth weight, hdl cholesterol, neuroblastoma (brain cancer), primary rhegmatogenous retinal detachment, tetrology of fallot, waist hip ratio