rs949155 chr11:123111608 C>G
- Sequence
agaatttacttagggaggattagc[C/G]aggcctcacctttaaggtagttat
- ASB in cell types
- upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| upper lobe of left lung | -2.49 | 1.30 | 1.33 |
Items per page:
1 – 1 of 1