rs951772 chr12:52380374 G>A
- Sequence
tgagagtactcaccggctctcctc[G/A]ccctccagcaggcgcctgtaggtg
- ASB in cell types
- GM02630 (Fanconi anemi) adrenal gland T47D (invasive ductal carcinoma) Peyer's patch
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | -0.88 | 1.06 | 1.00 | |||
| adrenal gland | 1.95 | -1.65 | 1.00 | |||
| T47D (invasive ductal carcinoma) | 0.72 | 0.19 | 1.09 | |||
| Peyer's patch | -1.23 | 1.23 | 1.00 | |||
| foreskin keratinocyte | 1.04 | n/a | 2.83 |
Items per page:
1 – 5 of 7