rs951995 chr13:40126593 C>T
- Sequence
ataaaattggttgcaaacagaatc[C/T]ctcaggcttggctgcacattagaa
- ASB in cell types
- germinal center B-cells
- ASB for transcription factors
- CBP_HUMAN MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CBP_HUMAN | 2.60 | -1.82 | 2.00 | n/a | n/a | |||
| MEF2B_HUMAN | 1.66 | -0.35 | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, bipolar disorder, hdl cholesterol change with statins, homa-b, major depressive disorder, rheumatoid arthritis