rs952064 chr6:105727096 T>A
- Sequence
ccccttcccacttgtggcatgctc[T/A]gagtatgcctgggcaggagaccca
- ASB in cell types
- LHSAR (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LHSAR (prostate epithelial cells) | 1.48 | -0.45 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP microalbuminuria, mitral annular calcium, total cholesterol, urinary albumin-to-creatinine ratio