rs9523 chr19:49907875 T>C
- Sequence
catttggtattttttcatgacacc[T/C]atgactatgctttggagagagtgg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- COT1_HUMAN HTF4_HUMAN IKZF1_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT1_HUMAN | 2.75 | -2.44 | 1.00 | n/a | No Hit | |||
| HTF4_HUMAN | 2.46 | -2.49 | 1.00 | n/a | No Hit | |||
| IKZF1_HUMAN | 2.27 | -0.32 | 1.25 | n/a | n/a | |||
| IKZF2_HUMAN | 1.80 | 0.10 | 1.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood