rs952400 chr18:57749263 C>A
- Sequence
gctcaccccatctccagcccctac[C/A]ccacaaaggcaagtagtacagaga
- ASB in cell types
- SUM159PT (Triple negative breast cancer)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 0.03 | 1.38 | 1.21 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, hypertension (early onset hypertension), microalbuminuria, triglycerides