rs955978 chr6:23446006 A>C
- Sequence
tgcaaacctccaggtttacacaaa[A/C]acaatgaaaagggttcttcattgt
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 1.75 | -1.44 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), hip bone mineral density (bmd), prop taste detection threshold, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, tetrology of fallot