rs957008 chr8:27276583 A>C
- Sequence
gcaatgacgacattttctttggtg[A/C]ctatttcatttgttgtcattcttt
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- ATF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF2_HUMAN | 2.90 | -2.88 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, hdl cholesterol, hip bone mineral density (bmd), neuroblastoma (brain cancer), spine bone mineral density (bmd), suicide attempts in bipolar disorder