rs957414 chr2:206800861 T>A
- Sequence
tcactaggagcgggtgcaaaatac[T/A]cttgcctgtgaggcctcttcaggt
- ASB in cell types
- foreskin keratinocyte MS-1 (Small cell lung carcinoma) upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -2.25 | 1.10 | 2.00 | |||
| MS-1 (Small cell lung carcinoma) | 0.48 | -0.36 | 1.00 | |||
| upper lobe of left lung | 1.86 | -0.29 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_EBV-transformed_lymphocytes, Muscle_Skeletal, Nerve_Tibial, Testis