rs957870 chr2:76752289 T>G
- Sequence
tttaatttaaactatagtgggaga[T/G]aacaatttcatagctaagaaatca
- ASB in cell types
- LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 1.96 | -0.19 | 1.67 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, comorbid depressive syndrome and alcohol dependence, femoral neck bone mineral density (bmd) (postmenopausal females), lumbar spine bone mineral density (bmd) (postmenopausal females), maternal transmission distortion, primary rhegmatogenous retinal detachment, prop taste detection threshold, simpson-angus scale, total hip bone mineral density (bmd) (postmenopausal females)