rs958755 chr3:56682894 T>G
- Sequence
aggccgccgccgccgccattttgt[T/G]gggaggactcaagctccggaagcg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HepG2 (hepatoblastoma)
- ASB for transcription factors
- BRD2_HUMAN AGO2_HUMAN TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD2_HUMAN | 0.20 | 1.25 | 2.10 | n/a | n/a | |||
| AGO2_HUMAN | -0.57 | 1.52 | 1.33 | n/a | n/a | |||
| TYY1_HUMAN | 0.48 | 0.69 | 1.29 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, alzheimers disease, college completion, diastolic blood pressure (dbp), hdl cholesterol, height, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp), triglycerides, urinary albumin-to-creatinine ratio, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid