rs958790 chr2:101419298 G>T
- Sequence
gggccacagggcacagcccagaga[G/T]aataaatgttcattgactgactga
- ASB in cell types
- KMS-11 (Plasma cell myeloma) HMEC (human mammary epithelial cells) CD34+ stem cells-derived erythroblasts
- ASB for transcription factors
- NFIC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFIC_HUMAN | -1.94 | 2.72 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood