rs959662 chr5:142328041 A>G
- Sequence
catttgctccattgcagggtgaag[A/G]catcatgttccttctttaggattg
- ASB in cell types
- LHSAR (prostate epithelial cells)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.43 | -0.05 | 1.83 | -4.06 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, eye color, fasting blood glucose, hypertension (early onset hypertension), partial epilepsy, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, testicular germ cell tumor (testicular cancer), triglycerides, waist hip ratio