rs960430 chr6:161498676 G>C
- Sequence
cctgccgaccctgatggagaacga[G/C]gtcacatcagtctccctgccaacc
- ASB in cell types
- GBM39 (Human brain tumor) LNCaP (prostate carcinoma) FT282 (normal human fallopian tube tissue) GM19193 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN SMC3_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.53 | 2.06 | 1.48 | n/a | No Hit | |||
| SMC3_HUMAN | -0.82 | 3.34 | 2.00 | n/a | n/a | |||
| GCR_HUMAN | 1.15 | 2.03 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), chronic kidney disease, diastolic blood pressure (dbp), systolic blood pressure (sbp)