rs961339 chr14:94423713 C>G
- Sequence
agaagtcccaaagctctgctggga[C/G]tcaacacttgggcagcctagcagt
- ASB in cell types
- MCF10AT1 (breast premetastatic epithelial cells) MCF10CA1a (breast metastatic epithelial cells) KMS-11 (Plasma cell myeloma) GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10AT1 (breast premetastatic epithelial cells) | -3.29 | 3.18 | 1.00 | |||
| MCF10CA1a (breast metastatic epithelial cells) | -3.38 | 3.23 | 1.00 | |||
| KMS-11 (Plasma cell myeloma) | -1.07 | 2.40 | 1.83 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -2.54 | 1.24 | 1.33 |
Items per page:
1 – 4 of 4