rs961731 chr1:199463736 A>C
- Sequence
tagagcaccctctagtgctaagac[A/C]actgcagttatcacatgctcagaa
- ASB in cell types
- T47D (invasive ductal carcinoma) MS-1 (Small cell lung carcinoma) erythroid progenitors GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.37 | 0.28 | 1.30 | n/a | No Hit | |||
| STAG1_HUMAN | 0.72 | 0.32 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2