rs962818 chr3:62798104 G>C
- Sequence
cattaaataaacattccagactga[G/C]ataaacgcaatgaagcagataaac
- ASB in cell types
- D341 Med (medulloblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| D341 Med (medulloblastoma) | 1.08 | -0.28 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, weight loss after gastric bypass surgery