rs963386 chr6:137298141 T>G
- Sequence
acaggaaacctgatagggaagccg[T/G]agtgtgtcatccctgactacccca
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.95 | -3.81 | 2.00 | |||
| macrophages form periferal blood | 2.11 | 0.77 | 2.00 |
Items per page:
1 – 2 of 2