rs963460 chr10:112721311 G>A
- Sequence
gagcactcacttaccattgccata[G/A]ttaacagttatttagcaacgctac
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines) KMS-11 (Plasma cell myeloma) erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -2.60 | 3.03 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | 1.78 | 0.10 | 1.00 | |||
| KMS-11 (Plasma cell myeloma) | -0.03 | 2.58 | 2.00 | |||
| erythroid progenitors | 2.34 | -1.38 | 2.00 |
Items per page:
1 – 4 of 4