rs963740 chr13:50521959 A>T
- Sequence
aattaagtaacaactgcagattac[A/T]caagggtaaacactgctgctaatg
- ASB in cell types
- HEK293 (embryonic kidney) liver breast tumor VCaP (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN CTBP1_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 1.44 | 0.21 | 1.75 | 0.31 | Weak Discordant | |||
| CTBP1_HUMAN | -5.32 | 3.14 | 2.00 | n/a | n/a | |||
| GCR_HUMAN | 1.34 | 0.10 | 1.40 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP decrease in fev1 (in nonasthmatic ever smokers), decrease in fev1 (in nonasthmatic never smokers), decrease in fev1 (in nonasthmatic participants), lung function, forced expiratory volume in 1 second (fev1) percent predicted (in nonasthmatic participants), mitral annular calcium, triglycerides, urinary albumin-to-creatinine ratio