rs963986 chr17:42409561 G>C
- Sequence
gggacaggagacgaaacaacttga[G/C]ctgaatcctgggatgatgtccaat
- ASB in cell types
- adipose HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- PPARG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PPARG_HUMAN | 3.37 | -4.26 | 2.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis