rs964533 chr3:161031231 C>A
- Sequence
tatggcagaaaattcatgaagata[C/A]cacaggcgcaagctggaaagtagt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF7L-P(immortalized breast epithelial cell line)
- ASB for transcription factors
- ESR1_HUMAN FOXA1_HUMAN ZN217_HUMAN SMCE1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 0.32 | 2.21 | 2.37 | n/a | No Hit | |||
| FOXA1_HUMAN | 0.26 | 1.39 | 2.16 | n/a | No Hit | |||
| ZN217_HUMAN | -2.11 | 2.59 | 1.50 | n/a | n/a | |||
| SMCE1_HUMAN | n/a | 3.10 | 1.50 | n/a | n/a | |||
| GATA3_HUMAN | -1.28 | 1.46 | 2.00 | 4.40 | Concordant |
Items per page:
1 – 5 of 8
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Uterus