rs9655367 chr7:36109369 G>A
- Sequence
ctgctgtccaccacctgaggtttc[G/A]ctatctgcactctgctttcagcct
- ASB in cell types
- breast tumor
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.97 | -0.54 | 1.83 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, abnormal involuntary movement scale, advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, systolic blood pressure (sbp)
GTEx eQTL Artery_Tibial, Colon_Sigmoid, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis