rs9655959 chr7:88279073 C>T
- Sequence
atacttctattggattttgcaaga[C/T]attaggtcatgcatgttgcccata
- ASB in cell types
- JB6 (Human anaplastic large cell lymphoma) MDM(monocyte derived macrophages) CD14+ monocytes monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- CEBPB_HUMAN STAT1_HUMAN SPI1_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 2.25 | 2.68 | 2.50 | -0.03 | Weak Discordant | |||
| STAT1_HUMAN | 2.23 | -0.82 | 2.00 | n/a | No Hit | |||
| SPI1_HUMAN | 2.19 | -0.21 | 2.07 | n/a | No Hit | |||
| TF65_HUMAN | 2.02 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GRASP ldl cholesterol, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), major depressive disorder (narrow definition) (females), prop taste detection threshold
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood