rs965795 chr5:58649002 A>G
- Sequence
ttaatcaccgaggttataaaccaa[A/G]catcagtttccttcacattccttc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 1.39 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, hip bone mineral density (bmd), parkinsons disease, prop taste detection threshold, stabilized warfarin dose, systolic blood pressure (sbp), total cholesterol change with statins
GTEx eQTL Artery_Tibial, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid