rs9659240 chr1:204791934 T>C
- Sequence
ggctgtcctggcgtgggtcctatc[T/C]cagggctggaccagttccgctagg
- ASB in cell types
- tibial nerve HEK293 (embryonic kidney) HBMEC (human brain microvascular endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| tibial nerve | 2.54 | -2.26 | 1.00 | |||
| HEK293 (embryonic kidney) | 0.05 | 0.84 | 1.97 | |||
| HBMEC (human brain microvascular endothelial cells) | 2.05 | -1.70 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), diabetic retinopathy in type 2 diabetes mellitus, homa-b, mitral annular calcium, total cholesterol
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Prostate, Stomach